mRNA, Protein and Translation

Q

How to derive protein sequence from a mRNA sequence?

✍: FYIcenter.com

A

Biologically, the protein sequence is produced by a translation process from a mRNA sequence.

We can simulate this biological translation process using the translation() function.

fyicenter$ python
>>> from Bio.Seq import Seq

>>> messenger_rna = Seq("AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG")
>>> messenger_rna
Seq('AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG')

>>> protein = messenger_rna.translate()
>>> protein
Seq('MAIVMGR*KGAR*')

We can also derive the protein sequence from the DNA coding strand, using the same translate() function.

>>> coding_dna = Seq("ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG")
>>> coding_dna
Seq('ATGGCCATTGTAATGGGCCGCTGAAAGGGTGCCCGATAG')

>>> protein = coding_dna.translate()
>>> protein
Seq('MAIVMGR*KGAR*')

Note that "*" in the protein sequence is the stop symbol.

⇒ What Are Translation Tables

⇐ Double Stranded DNA, mRNA and Transcription

⇑ Biopython - Tools for Biological Computation

⇑⇑ OBF (Open Bioinformatics Foundation) Tools

2023-03-17, 1331🔥, 0💬

What Is Biopython
What is BioJava? Biopython is a set of freely available tools for biological computation written in Python by an international team of developers. Biopython versions and release dates are: Biopython 1.80, November 18, 2022 Main features of Biopython: The ability to parse bioinformatics files into Py... 2023-02-04, 1382🔥, 0💬

Install Biopython
How to install Biopython? The easiest way to install Biopython is to use the "pip" command as shown below. 1. Make sure that Python 3 is installed. fyicenter$ python --version Python 3.8.8 2. Install Biopython. fyicenter$ pip install biopython Requirement already satisfied: numpy in ... Installing c... 2023-02-04, 1360🔥, 0💬

mRNA, Protein and Translation
How to derive protein sequence from a mRNA sequence? Biologically, the protein sequence is produced by a translation process from a mRNA sequence. We can simulate this biological translation process using the translation() function. fyicenter$ python >>> from Bio.Seq import Seq ... 2023-03-17, 1332🔥, 0💬

List NCBI Databases with Bio.Entrez.einfo()
How to List NCBI Databases with Bio.Entrez.einfo() function? Bio.Entrez.einfo() function allows you to list NCBI Databases and their related information. It uses the Entrez Web services provided by www.ncbi.nlm.nih.gov. 1. Get a list of NCBI databases. fyicenter$ python >>> from... 2023-07-08, 1314🔥, 0💬

What Are Translation Tables
What Are Translation Tables? Translation tables, also called codon tables, are conversion tables that map 3-nucleobase combinations into amino acids to form protein sequences. It is known that all organisms do not use exactly the same translation table. But they vary from a standard translation tabl... 2023-03-17, 1302🔥, 0💬

Single Sequence Record in GenBank Format
How to read a Single Sequence Record in GenBank Format? The GenBank format for DNA or protein sequences contains more properties and a better structure that FASTA format. You can follow these steps to download GenBank file example and create a Bio.SeqRecord object. 1. Download an example of a Sequen... 2023-04-04, 1280🔥, 0💬

Single Sequence Record in FASTA Format
How to read a Single Sequence Record in FASTA Format? If you want to store additional information to a DNA or protein sequence, you can use the Bio.SeqRecord class, which contains the following properties: seq – The sequence itself as a Seq object. id – The primary ID used to identify the sequence. ... 2023-04-04, 1230🔥, 0💬

Play with the Bio.Seq Module
How to import the Bio.Seq module and use its functions? Here are some examples on how to import the Bio.Seq module and use its functions. 1. Import the Bio.Seq module and create a Bio.Seq object. fyicenter$ python >>> from Bio.Seq import Seq >>> my_seq = Seq... 2023-02-04, 1222🔥, 0💬

Biopython - Tools for Biological Computation
Where to find FAQ (Frequently Asked Questions) on Biopython - Tools for Biological Computation? Here is a list of tutorials to answer many frequently asked questions compiled by FYIcenter.com team on Biopython - Tools for Biological Computation. What Is Biopython Install Biopython Play with the Bio.... 2023-02-04, 1184🔥, 0💬

All rights in the contents of this web site are reserved by the individual author. fyicenter.com does not guarantee the truthfulness, accuracy, or reliability of any contents.