What Are Translation Tables

Q

What Are Translation Tables?

✍: FYIcenter.com

A

Translation tables, also called codon tables, are conversion tables that map 3-nucleobase combinations into amino acids to form protein sequences.

It is known that all organisms do not use exactly the same translation table. But they vary from a standard translation table slightly.

Biopython uses the standard translation table by default. You need to specify the table name, if you want to use a non-standard translation table.

The code below prints the standard translation table, which is indexed as table 1.

fyicenter$ python 
>>> from Bio.Data import CodonTable

>>> standard_table = CodonTable.unambiguous_dna_by_id[1]
>>> print(standard_table)
Table 1 Standard, SGC0

  |  T      |  C      |  A      |  G      |
--+---------+---------+---------+---------+--
T | TTT F   | TCT S   | TAT Y   | TGT C   | T
T | TTC F   | TCC S   | TAC Y   | TGC C   | C
T | TTA L   | TCA S   | TAA Stop| TGA Stop| A
T | TTG L(s)| TCG S   | TAG Stop| TGG W   | G
--+---------+---------+---------+---------+--
C | CTT L   | CCT P   | CAT H   | CGT R   | T
C | CTC L   | CCC P   | CAC H   | CGC R   | C
C | CTA L   | CCA P   | CAA Q   | CGA R   | A
C | CTG L(s)| CCG P   | CAG Q   | CGG R   | G
--+---------+---------+---------+---------+--
A | ATT I   | ACT T   | AAT N   | AGT S   | T
A | ATC I   | ACC T   | AAC N   | AGC S   | C
A | ATA I   | ACA T   | AAA K   | AGA R   | A
A | ATG M(s)| ACG T   | AAG K   | AGG R   | G
--+---------+---------+---------+---------+--
G | GTT V   | GCT A   | GAT D   | GGT G   | T
G | GTC V   | GCC A   | GAC D   | GGC G   | C
G | GTA V   | GCA A   | GAA E   | GGA G   | A
G | GTG V   | GCG A   | GAG E   | GGG G   | G
--+---------+---------+---------+---------+--

The second table provided in Biopython is for Vertebrate Mitochondrial.

>>> mito_table = CodonTable.unambiguous_dna_by_id[2]
>>> print(mito_table)
Table 2 Vertebrate Mitochondrial, SGC1

  |  T      |  C      |  A      |  G      |
--+---------+---------+---------+---------+--
T | TTT F   | TCT S   | TAT Y   | TGT C   | T
T | TTC F   | TCC S   | TAC Y   | TGC C   | C
T | TTA L   | TCA S   | TAA Stop| TGA W   | A
T | TTG L   | TCG S   | TAG Stop| TGG W   | G
--+---------+---------+---------+---------+--
C | CTT L   | CCT P   | CAT H   | CGT R   | T
C | CTC L   | CCC P   | CAC H   | CGC R   | C
C | CTA L   | CCA P   | CAA Q   | CGA R   | A
C | CTG L   | CCG P   | CAG Q   | CGG R   | G
--+---------+---------+---------+---------+--
A | ATT I(s)| ACT T   | AAT N   | AGT S   | T
A | ATC I(s)| ACC T   | AAC N   | AGC S   | C
A | ATA M(s)| ACA T   | AAA K   | AGA Stop| A
A | ATG M(s)| ACG T   | AAG K   | AGG Stop| G
--+---------+---------+---------+---------+--
G | GTT V   | GCT A   | GAT D   | GGT G   | T
G | GTC V   | GCC A   | GAC D   | GGC G   | C
G | GTA V   | GCA A   | GAA E   | GGA G   | A
G | GTG V(s)| GCG A   | GAG E   | GGG G   | G
--+---------+---------+---------+---------+--

Here is how to specify the table name with calling the translation() function.

fyicenter$ python
>>> from Bio.Seq import Seq

>>> messenger_rna = Seq("AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG")
>>> messenger_rna
Seq('AUGGCCAUUGUAAUGGGCCGCUGAAAGGGUGCCCGAUAG')

>>> standard_protein = messenger_rna.translate(table=1)
>>> standard_protein
Seq('MAIVMGR*KGAR*')

>>> mito_protein = coding_dna.translate(table="Vertebrate Mitochondrial")
>>> mito_protein
Seq('MAIVMGRWKGAR*')

 

Single Sequence Record in FASTA Format

mRNA, Protein and Translation

Biopython - Tools for Biological Computation

⇑⇑ OBF (Open Bioinformatics Foundation) Tools

2023-03-17, 1145🔥, 0💬