Install Biopython

Q

How to install Biopython?

✍: FYIcenter.com

A

The easiest way to install Biopython is to use the "pip" command as shown below.

1. Make sure that Python 3 is installed.

fyicenter$ python --version 

Python 3.8.8

2. Install Biopython.

fyicenter$ pip install biopython

Requirement already satisfied: numpy in ...
Installing collected packages: biopython
Successfully installed biopython-1.80

3. Verify installation.

fyicenter$ python
Python 3.8.8 (default, Apr 13 2021, 19:58:26) 
[GCC 7.3.0] :: Anaconda, Inc. on linux
Type "help", "copyright", "credits" or "license" for more information.

>>> import Bio
>>> print(Bio.1.00)
1.80

⇒ Play with the Bio.Seq Module

⇐ What Is Biopython

⇑ Biopython - Tools for Biological Computation

⇑⇑ OBF (Open Bioinformatics Foundation) Tools

2023-02-04, 1431🔥, 0💬

What Is OBF (Open Bioinformatics Foundation)
What Is OBF (Open Bioinformatics Foundation)? OBF (Open Bioinformatics Foundation) is a non-profit, volunteer-run group dedicated to promoting the practice and philosophy of Open Source software development and Open Science within the biological research community. Currently, OBF supports the follow... 2023-02-04, 1854🔥, 0💬

What Is Biopython
What is BioJava? Biopython is a set of freely available tools for biological computation written in Python by an international team of developers. Biopython versions and release dates are: Biopython 1.80, November 18, 2022 Main features of Biopython: The ability to parse bioinformatics files into Py... 2023-02-04, 1472🔥, 0💬

Install Biopython
How to install Biopython? The easiest way to install Biopython is to use the "pip" command as shown below. 1. Make sure that Python 3 is installed. fyicenter$ python --version Python 3.8.8 2. Install Biopython. fyicenter$ pip install biopython Requirement already satisfied: numpy in ... Installing c... 2023-02-04, 1432🔥, 0💬

mRNA, Protein and Translation
How to derive protein sequence from a mRNA sequence? Biologically, the protein sequence is produced by a translation process from a mRNA sequence. We can simulate this biological translation process using the translation() function. fyicenter$ python >>> from Bio.Seq import Seq ... 2023-03-17, 1418🔥, 0💬

What Are Translation Tables
What Are Translation Tables? Translation tables, also called codon tables, are conversion tables that map 3-nucleobase combinations into amino acids to form protein sequences. It is known that all organisms do not use exactly the same translation table. But they vary from a standard translation tabl... 2023-03-17, 1351🔥, 0💬

Play with the Bio.Seq Module
How to import the Bio.Seq module and use its functions? Here are some examples on how to import the Bio.Seq module and use its functions. 1. Import the Bio.Seq module and create a Bio.Seq object. fyicenter$ python >>> from Bio.Seq import Seq >>> my_seq = Seq... 2023-02-04, 1298🔥, 0💬

Single Sequence Record in FASTA Format
How to read a Single Sequence Record in FASTA Format? If you want to store additional information to a DNA or protein sequence, you can use the Bio.SeqRecord class, which contains the following properties: seq – The sequence itself as a Seq object. id – The primary ID used to identify the sequence. ... 2023-04-04, 1292🔥, 0💬

About OBF (Open Bioinformatics Foundation)
Where to find FAQ (Frequently Asked Questions) in understanding what is OBF (Open Bioinformatics Foundation)? Here is a list of tutorials to answer many frequently asked questions compiled by FYIcenter.com team in understanding what is OBF (Open Bioinformatics Foundation). What Is OBF (Open Bioinfor... 2023-02-04, 1271🔥, 0💬

Double Stranded DNA, mRNA and Transcription
What are Double Stranded DNA and mRNA sequences? A Double Stranded DNA sequence actually contains two nucleotide strands. Here is a made-up example: DNA coding strand (aka Crick strand, strand +1) 5' ATGGCCATTGTAATGGGCCGCTGAAAGGGT GCCCGATAG3' DNA template strand (aka Watson strand, strand −1) which ... 2023-03-17, 1238🔥, 0💬

All rights in the contents of this web site are reserved by the individual author. fyicenter.com does not guarantee the truthfulness, accuracy, or reliability of any contents.