<< < 2 3 4 5 6 7 8 9 10 11 12 > >>   ∑:312  Sort:Rank

Double Stranded DNA, mRNA and Transcription
What are Double Stranded DNA and mRNA sequences? A Double Stranded DNA sequence actually contains two nucleotide strands. Here is a made-up example: DNA coding strand (aka Crick strand, strand +1) 5' ATGGCCATTGTAATGGGCCGCTGAAAGGGT GCCCGATAG3' DNA template strand (aka Watson strand, strand −1) which ...
2023-03-17, 783🔥, 0💬

BioPerl Modules Installation Options
What are installation options for BioPerl modules? There are several ways to install one or more BioPerl modules. 1. Using "cpanm" command - Run "cpanm ..." to install the given module automatically from cpan.org repository, if have "cpanm" installed. For example, run "cpanm Bio::SeqIO" to install B...
2023-03-07, 1131🔥, 0💬

HOWTO Documents at BioPerl.org
What tutorials are provided at BioPerl.org? BioPerl.org provides the following tutorials in the format of HOWTO documents: Beginners HOWTO - Introduction to BioPerl for biologists. Features and Annotations HOWTO - Reading and writing detailed data associated with sequences. BlastPlus HOWTO - Create,...
2023-03-07, 891🔥, 0💬

Install BioPerl Package with "cpanm"
How to install BioPerl package with "cpanm" command? Using "cpanm" command is the best option to install the BioPerl distribution package automatically as shown in this tutorial on a CentOS computer: 1. Make sure that you have "cpanm" command installed. If not run the command below: fyicenter$ sudo ...
2023-02-28, 1274🔥, 0💬

Missing 3Dmol-min.js on Local 3Dmol Server
Why is my local 3Dmol server redirecting to browser to https://get.webgl.org/? If you access your local 3Dmol server with a browser, and you see the https://get.webgl.org/ Website displayed, it's most likely missing the 3Dmol-min.js file on the server. This may happen if 3Dmol server was not install...
2023-02-19, 1318🔥, 0💬

Code Bug in server.py in 3Dmol Source Code
Why am I getting the "Connection refused" error when accessing my local 3Dmol Viewer? If you are getting the "Connection refused" error when accessing your hosted 3Dmol Viewer over the network, it's most likely caused by the code bug in the server's Python source code. 1. Make sure that your 3Dmol V...
2023-02-19, 1129🔥, 0💬

What Is Embedded 3Dmol Viewer
What Is Embedded 3Dmol Viewer? Embedded 3Dmol Viewer is a built-in 3Dmol viewer in the 3Dmol.js library. You can assign the Embedded 3Dmol Viewer to a DIV element in your HTML document using a special "class=viewer_3Dmoljs" attribute. Molecule data, display styles and other options can be specified ...
2023-02-05, 1066🔥, 0💬

Using Embedded 3Dmol Viewer
Where to find FAQ (Frequently Asked Questions) on Using Embedded 3Dmol Viewer? Here is a list of tutorials to answer many frequently asked questions compiled by FYIcenter.com team on Using Embedded 3Dmol Viewer. What Is Embedded 3Dmol Viewer Assign Embedded 3Dmol Viewer to DIV Multiple Selections wi...
2023-02-05, 1060🔥, 0💬

OBF (Open Bioinformatics Foundation) Tools
Where to find molecule FAQ (Frequently Asked Questions)? I want to learn more about OBF (Open Bioinformatics Foundation) and its software tools. Here is a large collection of tutorials to answer many frequently asked questions compiled by FYIcenter.com team about OBF (Open Bioinformatics Foundation)...
2023-02-04, 3990🔥, 0💬

Install Biopython
How to install Biopython? The easiest way to install Biopython is to use the "pip" command as shown below. 1. Make sure that Python 3 is installed. fyicenter$ python --version Python 3.8.8 2. Install Biopython. fyicenter$ pip install biopython Requirement already satisfied: numpy in ... Installing c...
2023-02-04, 1024🔥, 0💬

What Is Biopython
What is BioJava? Biopython is a set of freely available tools for biological computation written in Python by an international team of developers. Biopython versions and release dates are: Biopython 1.80, November 18, 2022 Main features of Biopython: The ability to parse bioinformatics files into Py...
2023-02-04, 961🔥, 0💬

What Is OBF (Open Bioinformatics Foundation)
What Is OBF (Open Bioinformatics Foundation)? OBF (Open Bioinformatics Foundation) is a non-profit, volunteer-run group dedicated to promoting the practice and philosophy of Open Source software development and Open Science within the biological research community. Currently, OBF supports the follow...
2023-02-04, 955🔥, 0💬

Play with the Bio.Seq Module
How to import the Bio.Seq module and use its functions? Here are some examples on how to import the Bio.Seq module and use its functions. 1. Import the Bio.Seq module and create a Bio.Seq object. fyicenter$ python &gt;&gt;&gt; from Bio.Seq import Seq &gt;&gt;&gt; my_seq = Seq...
2023-02-04, 928🔥, 0💬

Biopython - Tools for Biological Computation
Where to find FAQ (Frequently Asked Questions) on Biopython - Tools for Biological Computation? Here is a list of tutorials to answer many frequently asked questions compiled by FYIcenter.com team on Biopython - Tools for Biological Computation. What Is Biopython Install Biopython Play with the Bio....
2023-02-04, 925🔥, 0💬

About OBF (Open Bioinformatics Foundation)
Where to find FAQ (Frequently Asked Questions) in understanding what is OBF (Open Bioinformatics Foundation)? Here is a list of tutorials to answer many frequently asked questions compiled by FYIcenter.com team in understanding what is OBF (Open Bioinformatics Foundation). What Is OBF (Open Bioinfor...
2023-02-04, 854🔥, 0💬

Assign Embedded 3Dmol Viewer to DIV
How to assign Embedded 3Dmol Viewer to a "div" element? Here is an HTML code example, Embedded-Viewer-PDB.html, that assigns the Embedded 3Dmol Viewer to in "div" element. It also uses "data-*" attributes to load a protein from the PDB Websites, creates a selection from chain A and displays it in ca...
2023-02-04, 1033🔥, 0💬

3Dmol.js Bug - data-ui=true Impacts on Selection
Why is the default style done after removing data-ui="true" in the embedded 3Dmol viewer? There seems to be code bug in the 3Dmol.js library. Here is an HTML code example, Embedded-Viewer-data-ui-Bug.ht ml,that contains 2 embedded viewers: one with data-ui="true" and the other without data-ui="true"...
2023-02-03, 1219🔥, 0💬

Multiple Selections with Embedded 3Dmol Viewer
How to create multiple selections apply different styles with Embedded 3Dmol Viewer? In order to create a separate selection, you need add a suffix code to the "data-select" attribute name as "data-select{code}". Then other selection related attributes can use the same suffix code to refer to the se...
2023-02-03, 927🔥, 0💬

Load Data by URL into Embedded 3Dmol Viewer
How to load data by URL into the Embedded 3Dmol Viewer? You can use "data-href" and "data-type" attributes on the DIV element to load molecule data from a URL into the Embedded 3Dmol Viewer. Here is an HTML code example, Embedded-Viewer-data-href.html ,that loads a Benzene molecule in SDF format wit...
2023-02-03, 1455🔥, 0💬

UI Components of Embedded 3Dmol Viewer
What functions are supported by UI components on the Embedded 3Dmol Viewer? UI components on the Embedded 3Dmol Viewer support the following functions: 1. Model Data Input: Accessible through the first icon on the left. You can load PDB protein data from the online PDB database, or molecule compound...
2023-01-31, 1122🔥, 0💬

Load Data from Another HTML Element
How to load molecule data from another HTML element into the Embedded 3Dmol Viewer? You can use "data-element" and "data-type" attributes on the DIV element to load molecule data another HTML element into the Embedded 3Dmol Viewer. Here is an HTML code example, Embedded-Viewer-data-element.h tml,tha...
2023-01-31, 966🔥, 0💬

What Is Embedded 3Dmol Viewer
What Is Embedded 3Dmol Viewer? Embedded 3Dmol Viewer is a built-in 3Dmol viewer in the 3Dmol.js library. You can assign the Embedded 3Dmol Viewer to a DIV element in your HTML document using a special "class=viewer_3Dmoljs" attribute. Molecule data, display styles and other options can be specified ...
2023-01-30, 1296🔥, 0💬

Assign Embedded 3Dmol Viewer to DIV
How to assign Embedded 3Dmol Viewer to a "div" element? Here is an HTML code example, Embedded-Viewer-PDB.html, that assigns the Embedded 3Dmol Viewer to in "div" element. It also uses "data-*" attributes to load a protein from the PDB Websites, creates a selection from chain A and displays it in ca...
2023-01-30, 745🔥, 0💬

Multiple Selections with Embedded 3Dmol Viewer
How to create multiple selections apply different styles with Embedded 3Dmol Viewer? In order to create a separate selection, you need add a suffix code to the "data-select" attribute name as "data-select{code}". Then other selection related attributes can use the same suffix code to refer to the se...
2023-01-30, 666🔥, 0💬

<< < 2 3 4 5 6 7 8 9 10 11 12 > >>   ∑:312  Sort:Rank