Atom Biology General Molecule Reaction Tools Trial Virus

<< < 1 2 3   ∑:57  Sort:Date

Motif ICM Logo with WebLogo Tools
How to Create Motif ICM Logo with WebLogo Tools? Motif ICM Logo is a graphical representation of the ICM (Information Content Matrix). Motif ICM Logo is also referred as Multiple Sequence Alignment Logo, Sequence Conservation Logo, or Sequence Logo. You can use the WebLogo tool provided by US Berkel... 2023-04-26, 1082🔥, 0💬

Double Stranded DNA, mRNA and Transcription
What are Double Stranded DNA and mRNA sequences? A Double Stranded DNA sequence actually contains two nucleotide strands. Here is a made-up example: DNA coding strand (aka Crick strand, strand +1) 5' ATGGCCATTGTAATGGGCCGCTGAAAGGGT GCCCGATAG3' DNA template strand (aka Watson strand, strand −1) which ... 2023-03-17, 1081🔥, 0💬

HOWTO Documents at BioPerl.org
What tutorials are provided at BioPerl.org? BioPerl.org provides the following tutorials in the format of HOWTO documents: Beginners HOWTO - Introduction to BioPerl for biologists. Features and Annotations HOWTO - Reading and writing detailed data associated with sequences. BlastPlus HOWTO - Create,... 2023-03-07, 1076🔥, 0💬

Sequence Score against PSSM with Bio.motifs
How to Calculate Sequence Score against PSSM with Bio.motifs? With the motif PSSM (Position-Specific Scoring Matrix) defined in the previous tutorial, we can define a matching score of any given sequence against the motif: score = sum_over_j(PSSM[S[j], j]) where: S[i] is a given sequence PSSM[i, j] ... 2023-06-19, 1074🔥, 0💬

Search NCBI Databases with Bio.Entrez.esearch()
How to Search NCBI Databases with Bio.Entrez.esearch() function? Bio.Entrez.esearch() function allows you to search NCBI Databases with a given criteria. It uses the Entrez Web services provided by www.ncbi.nlm.nih.gov. 1. Search in PubMed for publications that include Biopython in their title. It r... 2023-08-09, 1063🔥, 0💬

Motif ICM with Bio.motifs
How to Calculate Motif ICM with Bio.motifs Module? ICM (Information Content Matrices) represents how important of each position over others. ICM can be expressed as: ICM[i,j] = PPM[i,j]*(IC t - U[j]) where: PPM[i,j] is the Position Probability Matrix IC t is the total IC: log 2 (n) n is the number o... 2023-05-31, 1061🔥, 0💬

Get Help Documentation with Biopython
How to Get Help Documentation with Biopython? Biopython has help documentations built in the library. You can use the help() to read them. Read help documentation on Biopython library. fyicenter$ python &gt;&gt;&gt; import Bio &gt;&gt;&gt; help(Bio) Help on package Bio: NAME ... 2023-07-29, 1041🔥, 0💬

Global Query on All NCBI Databases with Bio.Entrez.egquery()
How to Global Query on All NCBI Databases with Bio.Entrez.egquery() function? Bio.Entrez.egquery() function allows you to perform a global search on all NCBI Databases for a given key word. It uses the Entrez Web services provided by www.ncbi.nlm.nih.gov. Here is an example on how to do a global sea... 2023-08-25, 1015🔥, 0💬

Motif ICM as Relative Divergence with Bio.motifs
How to Calculate Motif ICM as Relative Divergence with Bio.motifs module? ICMRD (Information Content Matrices as Relative Divergence) represents how different a given PPM is from the uniform distribution. ICMRD can be expressed as: ICMRD[i,j] = PPM[i,j]*PSSM[i,j] where: PPM[i,j] is the Position Prob... 2023-05-31, 991🔥, 0💬

<< < 1 2 3   ∑:57  Sort:Date

Atom Biology General Molecule Reaction Tools Trial Virus