How to Read Motif in JASPAR Format with Bio.motifs Module?

The Bio.motifs.read() function allows to read motif files in several formats including JASPAR.

1. Download motif file in JASPER format by going to https://jaspar.genereg.net/matrix/MA0080.5/ and clicking the "JASPAR" download button. You see MA0080.5.jaspar file saved on your computer.

2. Read the motif file with read() function.

fyicenter$ python
>>> from Bio import motifs

>>> handle = open("MA0080.5.jaspar")
>>> m = motifs.read(handle, "jaspar")

>>> len(m)
20

3. View motif object structure.

>>> type(m)
<class 'Bio.motifs.jaspar.Motif'>

>>> print(m)
TF name  SPI1
Matrix ID  MA0080.5
Matrix:
          0        1        2        3        4        5         6         7 ...
A: 42201.00 48240.00 54154.00 78831.00 81904.00 99739.00  15301.00 113087.00 ...
C: 22587.00 21262.00 20183.00 11424.00 12269.00  2914.00  10958.00   3425.00 ...
G: 38405.00 34277.00 37341.00 25893.00 25580.00 13479.00 100825.00  12544.00 ...
T: 30010.00 29424.00 21525.00 17055.00 13450.00 17071.00   6119.00   4147.00 ...

4. View the consensus and anticonsensus sequences.

>>> m.consensus
Seq('AAAAAAGAGGAAGTGAAAAA')

>>> m.anticonsensus
Seq('CCCCCCTCCCTCTCTTCCCC')

5. Calculate the total number of sequences used by the motif by adding the counts on the first position.

>>> m.counts[:, 0]
{'A': 42201.0, 'C': 22587.0, 'G': 38405.0, 'T': 30010.0}

>>> sum(m.counts[:, 0].values())
133203.0

So 133,203 DNA sequences were used to create this motif. Those sequences are not included in the input file.

>>> type(m.instances)
<class 'NoneType'>

⇒ Motif PCM, PFM, PPM, PWM with Bio.motifs

⇐ Motif Counts and Consensus with Bio.motifs

⇑ Biopython for Sequence Motif Analysis

⇑⇑ OBF (Open Bioinformatics Foundation) Tools